Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice

Liu, Shu; Xiu, Jianbo; Zhu, Caiyun; Meng, Kexin; Li, Chen; Han, Rongrong; Du, Tingfu; Li, Lanlan; Xu, Lingdan; Liu, Renjie; Zhu, Wanwan; Shen, Yan; Xu, Qi

doi:10.1038/s41467-021-27044-7

Download PDF

Article
Open access
Published: 26 November 2021

Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice

Shu Liu^1,2^na1,
Jianbo Xiu^1,2^na1,
Caiyun Zhu^1,2^na1,
Kexin Meng^1,2^na1,
Chen Li^1,2,
Rongrong Han^1,2,
Tingfu Du^1,2,
Lanlan Li^1,2,
Lingdan Xu^1,2,
Renjie Liu^1,2,
Wanwan Zhu^1,2,
Yan Shen^1,2 &
…
Qi Xu ORCID: orcid.org/0000-0003-2660-8092^1,2

Nature Communications volume 12, Article number: 6937 (2021) Cite this article

9876 Accesses
39 Citations
9 Altmetric
Metrics details

Subjects

Abstract

Post-transcriptional modifications of RNA, such as RNA methylation, can epigenetically regulate behavior, for instance learning and memory. However, it is unclear whether RNA methylation plays a critical role in the pathophysiology of major depression disorder (MDD). Here, we report that expression of the fat mass and obesity associated gene (FTO), an RNA demethylase, is downregulated in the hippocampus of patients with MDD and mouse models of depression. Suppressing Fto expression in the mouse hippocampus results in depression-like behaviors in adult mice, whereas overexpression of FTO expression leads to rescue of the depression-like phenotype. Epitranscriptomic profiling of N6-methyladenosine (m⁶A) RNA methylation in the hippocampus of Fto knockdown (KD), Fto knockout (cKO), and FTO-overexpressing (OE) mice allows us to identify adrenoceptor beta 2 (Adrb2) mRNA as a target of FTO. ADRB2 stimulation rescues the depression-like behaviors in mice and spine loss induced by hippocampal Fto deficiency, possibly via the modulation of hippocampal SIRT1 expression by c-MYC. Our findings suggest that FTO is a regulator of a mechanism underlying depression-like behavior in mice.

The metabolic regulator USF-1 is involved in the control of affective behaviour in mice

Article Open access 01 December 2022

Deletion of Crtc1 leads to hippocampal neuroenergetic impairments associated with depressive-like behavior

Article Open access 12 October 2022

Shisa6 mediates cell-type specific regulation of depression in the nucleus accumbens

Article Open access 12 July 2021

Introduction

Major depressive disorder (MDD) is currently the leading cause of disability worldwide. MDD is characterized by low mood, diminished interests, feelings of despair or guilt, impaired cognition, and other symptoms¹. Epigenetic regulation of the genes by interaction with environments contributes to the pathophysiology of depression². Considerable progress has been made in the understanding of DNA methylation and histone modifications;³ however, the epitranscriptomic impact on depression remains largely elusive.

N6-methyladenosine (m⁶A) methylation that is the most abundant internal modification of eukaryotic mRNA occurs extensively in the brain^4,5, and is dynamic and reversible in mammals⁶. FTO is a well-characterized RNA demethylase and is highly expressed in multiple brain regions⁷. Previous studies demonstrated that FTO in the brain could regulate postnatal growth of mice⁸, activity of the dopaminergic midbrain circuitry⁹, memory processes in the prefrontal cortex¹⁰ and the hippocampus^11,12,13,14, brain development¹², adult neurogenesis¹², and axonal regeneration¹⁵. Several lines of evidence revealed that FTO was associated with depressive symptoms^16,17,18 and involved in the pathogenesis of MDD^11,19. Although these studies suggested that FTO could play a vital role in MDD, the mechanism behind specific induction of depression-like behaviors has yet to be clarified.

Here, we report that FTO in the hippocampus mediates depression-like behaviors through RNA demethylase activity. The expression of hippocampal FTO is decreased in patients with MDD and three mouse models of depression. Knockdown or knockout of Fto in the hippocampus induces depression-like behaviors, whereas overexpression of FTO has antidepressant effects. Epitranscriptomic analysis identifies ADRB2 likely to act as one of the targets modified by FTO. ADRB2 activation rescues depressive-like behaviors and spine loss caused by hippocampal FTO deficiency, and this effect is reversed by ADRB2 inhibition, suggesting the involvement of c-MYC in modulating hippocampal SIRT1 expression. It is conclusive that hippocampal FTO can be exploited to serve as a therapeutic target for depression.

Results

The expression of FTO is downregulated in the hippocampus of MDD patients and mouse models of depression

In microarray analysis of the peripheral blood of 36 MDD patients and 20 healthy controls, we found that both RNA methyltransferases (METTL3, METTL14, and WTAP) and demethylases (FTO and ALKBH5) were significantly downregulated in the patient group (Fig. 1a). Next, we examined the expression of these genes in another cohort using real-time quantitative PCR and the results also showed that both RNA methyltransferases (METTL3, METTL14, and WTAP) and demethylases (FTO and ALKBH5) were significantly downregulated in MDD (Fig. 1b). We further measured the expression of m⁶A-modifying enzymes in three mouse models of depression, which have been widely employed in preclinical studies of depression, including the chronic unpredictable mild stress (UCMS), chronic restraint stress (CRS), and social defeat stress (SDS) models. The mRNA expression of Fto and Alkbh5 in the peripheral blood of UCMS mice was significantly downregulated compared with control mice, whereas the expression levels of RNA methyltransferases remained unchanged (Fig. 1c). Behavioral tests showed that all three models of depression were successfully established (Fig. 1d, e, h, i, l, and m). We examined the mRNA expression of m⁶A-modifying enzymes in multiple brain regions involved in the regulation of emotions, including the prefrontal cortex (PFC), nucleus accumbens (NAC), amygdala (AMY), and hippocampus (HIP). We found that Fto was consistently downregulated in the hippocampus of all three animal models compared with the hippocampus of control mice (Fig. 1f, j, n), whereas there were either no changes or inconsistent changes in expression levels of the other enzymes examined (Supplementary Fig. 1a–c). Western blot analysis further confirmed that FTO was significantly downregulated in the hippocampus of all three mouse models compared with control mice (Fig. 1g, k, o). The postmortem study revealed that mRNA expression of FTO in the hippocampus of MDD patients was specifically and significantly decreased in the hippocampus of MDD patients compared with healthy controls (Fig. 1p, Supplementary Table 1).

**Fig. 1: Expression of FTO is decreased in the hippocampus of MDD patients and mouse models of depression.**

FTO mediates depression-like behaviors in the hippocampus

To test how hippocampal FTO contributes to depression-like behaviors, we employed recombinant adeno-associated virus (rAAV) as a transgenic tool to specifically knock down mouse FTO overexpressed in the hippocampus of wild-type C57BL/6 mice and to specifically knock out Fto in the hippocampus of Fto flox/flox mice. Four weeks after bilateral microinjection of rAAV into the hippocampus (Fig. 2a), FTO protein showed an expected level in shRNA-expressing (knockdown; KD), FTO-overexpressing (OE), and Cre-expressing (cKO) mice (Fig. 2b). Given that FTO catalyzes RNA demethylation, the m⁶A dot blot assay showed that the alteration of FTO expression levels increased m⁶A levels in hippocampal total RNA from KD and cKO mice and decreased m⁶A levels in hippocampal total RNA from OE mice (Fig. 2c). Next, we analyzed the behavioral consequences of changes in Fto expression. KD mice demonstrated longer immobility duration in the tail suspension test (TST) and lower sucrose preference in the sucrose preference test (SPT) than control mice (Fig. 2d, e). Compared with EGFP-expressing mice, cKO mice showed longer duration of immobility in the TST and the forced swimming test (FST) as well as longer latency to feeding in the novelty suppressed feeding test (NSFT) (Fig. 2f, g, h). These results suggest that suppressing Fto expression in the hippocampus is sufficient to induce depression-like behaviors in mice. Subsequently, we explored whether overexpression of FTO could lead to antidepressant effects. UCMS induced depression-like behaviors in EGFP-expressing mice, but stress-treated OE mice demonstrated shorter immobility duration in the TST and higher sucrose preference in the SPT than UCMS-treated EGFP-expressing mice (Fig. 2i–k). These results suggest that overexpression of FTO in the hippocampus has antidepressant effects.

**Fig. 2: FTO in the hippocampus mediates depression-like behaviors.**

Recent studies have reported various effects of systemic Fto knockout on anxiety-like behaviors in mice^13,19. Owing to the high comorbidity of depression and anxiety, we also analyzed the anxiety-like behaviors in KD and cKO mice. There was no significant difference in the time spent in the center zone in the open field test (OFT) between KD and control mice (Supplementary Fig. 2a). Additionally, in the elevated zero maze test (EZM), there was no significant difference in the time spent in the open arms between KD and control mice (Supplementary Fig. 2b). Similar results were observed in cKO mice (Supplementary Fig. 2c, d). These results are consistent with those from a previous study that used a specific Cre line to knock out Fto in the CA1 and CA3 regions of the hippocampus¹¹. Our study demonstrated that FTO in the hippocampus specifically mediated depression-like behaviors without affecting anxiety-like behaviors. Because specific deletion of Fto in the nervous system has been found to result in postnatal growth retardation⁸, we examined whether the depression-like phenotype observed in cKO mice was developed due to abnormal growth. However, there was no significant difference in body weight between control and cKO mice, indicating that downregulation of Fto in the hippocampus did not affect growth (Supplementary Fig. 3a). Moreover, after 24 h of food deprivation, there was no change in body weight between the two groups of mice (Supplementary Fig. 3b, c).

Modification of the hippocampal m⁶A epitranscriptome by FTO

Next, we focused on investigating the mechanism by which hippocampal FTO mediates depression-like behaviors. We performed m⁶A epitranscriptomic analysis of hippocampal mRNAs by MeRIP-Seq. After quality control, 47.01 to 76.53 million reads were generated from each m⁶A-seq library, 88.59% of which were uniquely mapped to the mouse genome and retained for further analysis (Supplementary Table 2). Approximately 25%–34% of the expressed genes were modified by m⁶A, with approximately 2.65 peaks per gene. The pattern of m⁶A modification distribution across the genes was similar among all groups (Supplementary Fig. 4a). Consistent with previous studies^5,20, the majority of m⁶A peaks were preferentially located in the 3’UTR and around the stop codon, and the enriched motifs in all samples contained ‘GGAC’, one of the most frequent m⁶A consensus motifs (Fig. 3a).

**Fig. 3: Hippocampal m⁶A epitranscriptome modified by FTO.**

Next, we analyzed the differentially methylated peaks (DMPs) among different groups (Fig. 3b). Most DMPs were distributed in exons and the 3’UTR (Supplementary Fig. 4b). KEGG pathway analysis showed that multiple gene clusters were enriched in Wnt, calcium, Notch, and axon guidance signaling pathways (Fig. 3c). Specifically, hypermethylated genes in cKO mice and hypomethylated genes in OE mice were both enriched in the neuroactive ligand-receptor interaction pathway. GO analysis demonstrated that the genes with hypomethylated peaks in OE mice were mostly enriched in the pathways regulating synapse organization and signal release, neurotransmitter secretion and transport, and neural precursor cell proliferation (Fig. 3d).

ADRB2 is a target gene of FTO in the hippocampus

Given that FTO is a well-characterized RNA demethylase, we analyzed hypermethylated mRNAs in KD and cKO mice, and hypomethylated mRNAs in OE mice (Fig. 4a). After mapping each peak to the corresponding gene, we found that 382 and 661 genes were hypermethylated in KD and cKO mice, respectively, while there were 613 hypomethylated genes in OE mice (Fig. 4b). Finally, we identified 34 genes that were both hypermethylated in KD and cKO mice and hypomethylated in OE mice (Fig. 4c; Supplementary Table 3). Gene-specific m⁶A qPCR analysis of Zfp217 and Ahnak confirmed the MeRIP-Seq results (Supplementary Fig. 4c). At the mRNA level, Zfp217 and Ahnak were downregulated in cKO mice and upregulated in OE mice compared with control mice (Supplementary Fig. 4d). Among these 34 genes, Adrb2 encodes the β2-adrenergic receptor, which has been reported to regulate synaptic plasticity, adult neurogenesis and neuroinflammation in the hippocampus, and exerts antidepressant effects^{21,22,23,24,25}. Therefore, we further examined whether ADRB2 contributed to FTO-mediated depression-like behaviors in the hippocampus. First, we confirmed that suppressing Fto expression hyper-methylated Adrb2 mRNA in KD and cKO mice, while FTO overexpression led to hypomethylation of Adrb2 mRNA in OE mice (Fig. 4d, g, j). At both the mRNA and protein levels, Adrb2 was downregulated in KD and cKO mice but upregulated in OE mice compared to control mice (Fig. 4e, f, h, i, k, and l). The postmortem study revealed that mRNA expression of Adrb2 was significantly lower in the hippocampus of MDD patients than healthy controls (Fig. 4m). Next, we performed luciferase reporter assays to determine whether ADRB2 was the direct target of FTO. Wild-type FTO increased luciferase activity of pMIR-GLO vectors bearing Adrb2−3′UTR with wild-type m⁶A sites compared with empty vector or mutant FTO vector. In contrast, wild-type FTO did not influence the activity of pMIR-GLO vectors bearing Adrb2 3′UTR with mutant m⁶A sites (Fig. 4q, r). We further investigated whether the changes in m⁶A methylation affected Adrb2 mRNA levels in Neuro-2a cells. In the presence of actinomycin D, an inhibitor of mRNA transcription, Fto knockdown accelerated the degradation of Adrb2 mRNA, whereas FTO overexpression significantly delayed this process (Fig. 4n, o). When YTHDF2, an m⁶A reader protein that regulates RNA stability²⁶, was knocked down, the Adrb2 mRNA levels were significantly increased (Fig. 4p). These results indicate that m⁶A modification is likely to affect the Adrb2 mRNA levels, at least partly by regulating its stability.

**Fig. 4: ADRB2 is one of the critical target genes of FTO in the hippocampus.**

ADRB2 activation reverses the depression-like behaviors and spine loss induced by hippocampal Fto deficiency

We investigated whether ADRB2 affected the phenotype induced by hippocampal Fto deficiency. We activated ADRB2 in cKO mice with formoterol (FOR), a specific ADRB2 agonist that can cross the blood-brain barrier (Fig. 5a). FOR administration rescued the depression-like behaviors of cKO mice in both the FST and TST in two groups of mice, while pretreatment with ICI 118,551 (ICI), a specific ADRB2 antagonist, blocked the effects of FOR (Fig. 5b, c). Specifically, hippocampal administration of FOR reversed the depression-like phenotype of Fto cKO mice (Supplementary Fig. 5a–c). Depression has been demonstrated to be linked to synaptic dysfunction in multiple brain regions, including the hippocampus²⁷. The cKO mice treated with FOR for seven consecutive days significantly increased the number of spines to a level comparable to that in EGFP-expressing mice, whereas pretreatment with ICI blocked these effects of FOR (Fig. 5d).

**Fig. 5: ADRB2 stimulation rescues depression-like behaviors and spine loss induced by hippocampal FTO deficiency.**

ADRB2 mediates depression-like behaviors possibly via the modulation of hippocampal SIRT1 expression by c-MYC

SIRT1, an NAD⁺-dependent deacetylase, is essential for synaptic plasticity in the hippocampus^28,29, and it has been reported that hippocampal SIRT1 signaling mediates depression-like behaviors³⁰. In this study, we found that the SIRT1 protein was downregulated in the hippocampus of cKO mice but upregulated in OE mice (Fig. 5e). However, in all three m⁶A-seq libraries, we detected no changes in the m⁶A level on Sirt1 mRNA, suggesting that FTO may regulate the expression of SIRT1 through other pathways. Recent studies have reported that ADRB2 activation upregulates SIRT1 expression in cervical cancer cells through promoting the expression of c-MYC³¹. In vitro, c-MYC can bind to the Sirt1 promoter and induce Sirt1 expression³². Our CHIP assay confirmed that c-MYC were bound to the promoter of Sirt1³³. Stimulation of ADRB2 significantly increased the abundance of c-MYC at the binding site of the Sirt1 promoter. Pretreatment with ICI blocked the effects of FOR on the abundance of c-MYC at the binding site of the Sirt1 promoter (Fig. 5f). Blocking ADRB2 significantly decreased SIRT1 protein levels in the hippocampus of wild-type mice after intraperitoneal administration of ICI (Fig. 5g). SIRT1 expression levels were obviously increased in FOR-treated cKO mice compared with saline-treated cKO mice, while pretreatment with ICI blocked the effects of FOR (Fig. 5h). Similar finding of SIRT1 expression was observed in c-MYC in OE or cKO mice (Fig. 5i). The results from specific administration of FOR into the hippocampus were also similar to those from intraperitoneal administration. FOR treatment obviously increased hippocampal SIRT1 and c-MYC expression in cKO mice compared with saline-treated cKO mice (Supplementary Fig. 5d, e). There was also no change in the m⁶A level on c-Myc mRNA in the KD, cKO, and OE m⁶A-seq libraries. FOR treatment also increased c-MYC expression in cKO mice compared with saline-treated cKO mice, while pretreatment with ICI blocked the effects of FOR (Fig. 5h). FOR-activated ADRB2 significantly increased c-MYC protein expression in wild-type mice compared with saline-treated mice, and this effect was blocked by pretreatment with ICI (Fig. 5j). Finally, overexpression of SIRT1 in the hippocampus of cKO mice effectively reversed the depression-like behaviors induced by Fto deficiency (Fig. 5k–n). These observations suggest that ADRB2 regulates downstream of FTO in the hippocampus to mediate depression-like behaviors and that ADRB2 may target SIRT1 through modulating the expression of c-MYC. Further, we investigated whether fluoxetine, the most widely prescribed antidepressant in clinical practice, could improve the depression-like behaviors in Fto cKO mice and whether the ADRB2-c-MYC-SIRT1 signaling pathway was involved in the actions of fluoxetine. We found that fluoxetine treatment significantly reversed the depression-like phenotype of Fto cKO mice (Fig. 6a–c). The expression levels of ADRB2, SIRT1, and c-MYC in the hippocampus were significantly higher in fluoxetine-treated than saline-treated cKO mice (Fig. 6d, e).

**Fig. 6: Fluoxetine rescues depression-like behaviors and ADRB2/c-MYC/SIRT1 protein expression induced by hippocampal FTO deficiency.**

Discussion

According to our findings, the expression of hippocampal FTO was decreased in both patients with MDD and the three mouse models of depression. Specific knockdown or knockout of Fto in the hippocampus could induce depression-like behaviors, whereas overexpression of FTO had antidepressant effects. Epitranscriptomic analysis identified ADRB2 as one of the targets modified by FTO. Loss of Fto in the hippocampus decreased the expression of ADRB2 by elevating m⁶A level in Adrb2 mRNA. Conversely, overexpression of FTO could increase the expression of ADRB2 by reducing m⁶A level in Adrb2 mRNA. ADRB2 stimulation could rescue depressive-like behaviors and spine loss caused by hippocampal FTO deficiency, which can be reversed by ADRB2 inhibition and may function via c-MYC to modulate hippocampal SIRT1 expression (Fig. 7). Interestingly, downregulation of hippocampal FTO did not affect anxiety-like behaviors that are often observed in stress-induced models of depression, including those employed in the current study. Although anxiety disorders and MDD are highly co-morbid, they are traditionally defined as two distinct diseases³⁴. At present, nonanxious MDD is distinguished from anxious MDD based on the cutoff score <7 for anxiety/somatization factor of Hamilton Depression Rating Scale (HAM-D) 17^35,36. Particularly, anxious MDD has a poorer response to antidepressants than nonanxious MDD, consistent with our antidepressant treatment of Fto knockout in hippocampus. While most of the existing depression models are comorbid with anxiety, our model of FTO deficiency in the hippocampus may serve as a model of nonanxious MDD. It would be interesting to further investigate the differential mechanisms of anxious versus nonanxious depression by comparing common depression models and the hippocampal FTO deficiency model. Genetic studies have shown that the FTO rs9939609 variant exerts a protective effect against depression;¹⁷ further analyses have revealed that this positive association is driven by an atypical MDD subtype¹⁶. However, the role of FTO in the pathophysiology of depression remains largely unknown. Inconsistent results regarding anxiety phenotypes found in different Fto mutant mice^11,13,19 highlight the regional specificity of the functions of FTO in the brain, such as modulation of dopaminergic signaling in the midbrain and regulation of fear memory in the prefrontal cortex. The present study demonstrated that FTO in the hippocampus was critical in mediating depression-like behaviors.

**Fig. 7: Schematic illustration summarizing the current work.**

MeRIP-seq assay and functional study confirmed that ADRB2 was an important target gene of FTO. Although FTO may target many mRNAs, our study focused on Adrb2 mRNA because ADRB2 can regulate synaptic plasticity and contribute to many mental disorders^22,23,24,37. Previous studies in animals have reported that stimulation of central beta 2 -adrenergic receptors can produce antidepressant-like effects³⁸. While a large number of studies indicate that activation of central ADRB2 can produce antidepressant-like effects on animals, the specific mechanisms remain unclear. In this study, however, we found that depleted expression of FTO increased m6A levels at 3′UTRs, leading to the downregulation of ADRB2 at both the RNA and protein levels. In contrast, the overexpression of FTO in the hippocampal tissues decreased m6A level and increased the expression of ADRB2. Wang et. al reported that m6A-containing mRNA was less stable because such mRNA could be relocalized to the decay sites by YTHDF2²⁶. According to our results, Fto knockdown accelerates the degradation of Adrb2 mRNA, and overexpression of FTO alleviates the degradation of Adrb2 mRNA. Taken together, the regulation of ADRB2 expression by FTO relies on demethylase activity to a certain extent.

Two loci, one of which is near the SIRT1 gene, were identified as the first robust links between genetics and depression at the whole-genome level³⁹. Recent studies reported that the expression of SIRT1 in the peripheral blood of MDD patients was significantly lower in patients with MDD than healthy controls⁴⁰, consistent with our microarray analysis (in-house data). Animal studies have also shown that SIRT1 regulates depression-like behaviors in several brain regions, including the hippocampus^30,41,42,43. We observed that the methylation level of Sirt1 mRNA was not modified by FTO but the expression level of SIRT1 protein was altered by FTO. Chen et al found that ADRB2 activation upregulated the expression of Sirt1 via elevating c-MYC expression in cervical cancer cells³¹. c-MYC is a transcriptional factor of Sirt1 and can regulate the expression of SIRT1 in vitro⁴⁴. Consistent with previous results, we found that injection of FOR increased the expression of c-MYC protein in the hippocampus whereas injection of ICI blocked this effect. In addition, the expression of c-MYC protein was decreased in the hippocampus of Fto cKO mice and increased in the hippocampus of FTO overexpression mice. We report that ADRB2 regulates SIRT1 expression in vivo in the hippocampus of wild-type and Fto-deficient mice. Both the activation of ADRB2 and the elevation of hippocampal SIRT1 levels reversed the depression-like behaviors induced by Fto deficiency, suggesting that FTO may target SIRT1 through modifying the methylation of Adrb2 mRNA. The limitation of the study is that only male mice were employed. In light of the established fact that mood disorders (such as MDD) have a higher incidence in women, therefore further work investigating the role of FTO in female mice may help elucidate potential sex-specific mechanisms underlying mood disorders.

Our study indicates that FTO in the hippocampus mediates depression-like behaviors and that hippocampal FTO can be exploited to serve as a therapeutic target for depression. Recently developed specific FTO inhibitors are promising for the treatment of cancer⁴⁵ and obesity⁴⁶. Based on our findings from several weight-loss drugs⁴⁷, an attention should be paid to potential adverse psychiatric events during systematic administration of FTO inhibitors.

Methods

All the subjects provided written informed consent to participate in this study that was approved by the Ethics Committee of the Chinese Academy of Medical Sciences and Peking Union Medical College. Hippocampal tissues of the human brain were provided by the Human Brain Bank, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China. The animal experiments were in accordance with the institutional guidelines of the Beijing Administration Office of Laboratory and this study was approved by the Institutional Review Board of Chinese Academy of Medical Sciences and Peking Union Medical College. The protocol number is 2019017. The donation of human tissue was voluntary and free, approved by the donor and all the donor’s direct family members. It was also approved that the donated human tissue will only be used for scientific research.

Human subjects

Thirty-six patients with MDD (20 women and 16 man) aged 39.9 ± 12.5 (SD) years and 20 healthy controls (10 women and 10 man) aged 36.6 ± 11.1 (SD) years were recruited through the Department of Psychiatry, First Hospital of Shanxi Medical University, Taiyuan, China. Fifty patients with MDD (27 women and 23 men) aged 31.5 ± 9.8 (SD) years and 50 healthy controls (28 women and 22 men) aged 29.5 ± 8.3 (SD) years were recruited to validate the result of microarray. None of these patients with MDD or healthy controls had taken any psychotropic medications within 4 weeks. All of the patients were clinically diagnosed by at least two psychiatrists in accordance with the Diagnostic and Statistical Manual of Mental Disorders Fourth Edition (DSM-IV) criteria and the 17-item Hamilton Rating Scale for Depression (HAMD-17). The postmortem intervals between the death of donors and brain collection were less than 40 h and their clinical information is detailed in Supplementary Table 1.

Microarray

Total blood RNA was isolated using a PAXgene Blood RNA Kit (Qiagen, 762174). The optical density values at 260/280 were approximately 1.9–2.0, and the quality of the RNA was also confirmed with an Agilent 2100 (Agilent Technologies, Santa Clara, CA). The RNA samples underwent reverse transcription to synthesize double-stranded complementary DNA (cDNA), and the cDNA was then transcribed into cRNA in vitro. The cRNA was then reverse-transcribed into cDNA that was then fluorescently labeled and hybridized using a 4 × 180 K lncRNA+mRNA Human Gene Expression Microarray V3.0 (CapitalBio Technology, Beijing, China). The Agilent Feature Extraction (v10.7) software (Santa Clara, CA, USA) was used to analyze the hybridization map and extract the data. The chip fluorescence scanning images were saved as DAT files for analysis by the Agilent G2565CA Microarray Scanner. The data normalization and difference analysis were performed using the Agilent GeneSpring software. Two groups of sample data were analyzed using a t-test analysis to obtain the P-values corrected for multiple testing and the fold change values. The microarray data were validated by qPCR (not published). The expression levels of the genes coding for RNA methylation-modifying enzymes were derived from the microarray data (in-house data).

Animals

C57BL/6 J male mice (4–6 weeks old) were purchased from Vital River Animal Technology Co., Ltd. (Beijing, China) and bred for 4–5 weeks to perform experiments. C57BL/6 J, Fto^fl/fl mice (Stock No. 027830) were provided by the Jackson Laboratory. These mice possessed loxP sites on either side of exon 3 of Fto. Removal of the floxed sequence by Cre recombinase created a null Fto allele. Male mice were housed under a 12-h light/dark cycle at 23 ± 2 °C.

Cell culture

The Neuro-2a cell line, provided by the Cell Resource Center (IBMS, CAMS/PUMC), was cultured in DMEM supplemented with 10% heat-inactivated fetal bovine serum (04-001-1 A, Biological Industries), 100 U/mL penicillin, and 100 μg/mL streptomycin at 37 °C in 5% CO₂. Plasmids were transfected into Neuro-2a cells using Neofect™ DNA transfection reagent (TF201201, China). siRNA targeting Ythdf2 (sc-155424, Santa Cruz) was transfected into Neuro-2a cells using RNAi MAX (13778150, Thermo).

Drug administration

Formoterol (F9552, Sigma) and ICI 118,551 (HY-13951, MedChemExpress) were diluted in saline and administered intraperitoneally at dosages of 2 mg/kg and 10 mg/kg, respectively. To block the effects of formoterol, ICI 118,551 was administered 30 min before formoterol. Fluoxetine (F132, Sigma) diluted in saline was administered intraperitoneally at dosage of 20 mg/kg daily for 14 days.

Mouse models of depression

Unpredictable chronic mild stress (UCMS)

The UCMS model was established in line with a previous work⁴⁸. The animals were subjected to 11 stressors at random for 35 days (three stressors per day from day 1 to day 21 and two stressors per day from day 22 to day 35; the stressors included a hot plate (45 °C/10 min), leaving the lights on overnight, turning the lights off in the daytime, bedding deprivation overnight, crowding (12 h), swimming stress (16 °C/3 min), food and water deprivation (12 h), wet bedding (12 h), an elevated platform (30 min), tilting of the cage at 45 °C (12 h), and restraint stress (1 h).

Chronic restraint stress (CRS)

We performed the CRS model by referring to a previous study⁴⁹. Mice were placed in polypropylene conical tubes (50 mL) with pores at the bottom enabling air flow. The animals had no access to food and water during restraint stress. Four hours later, the mice were returned to their home cages. The same stressor was administered once per day at a random time each day, during a total of 21 days.

Social defeat stress (SDS)

Social defeat stress exposure was performed in accordance with the published protocol⁵⁰. Briefly, C57BL/6 J mice were placed into a cage in the presence of CD-1 aggressor mice for 5–10 min per day for 10 consecutive days. The C57BL/6 J and CD-1 mice were then separated by a perforated Plexiglas plate for 24 h to prevent any physical contact. Each C57BL/6 J mouse was exposed to different CD-1 mice every day.

Behavioral tests

The animals were transported and acclimated to the testing room 1 h before each behavioral test.

Forced swimming test (FST)

Mice were individually placed in a beaker (height: 19 cm; diameter: 14 cm) containing 14 cm of water (23 ± 2 °C). The total test duration was 6 min. The process was videotaped, and the immobility time in the last 4 min was scored by an experienced observer blinded to the experimental treatment. Floating or only slight movement to maintain balance was considered as the immobility.

Tail suspension test (TST)

The TST was performed using tail suspension hardware (Med Associates, USA). Each mouse was suspended by its tail with a short adhesive tape connected to a load cell that transmitted a signal corresponding to activity. The total test time was 6 min. After setting a low threshold, the duration of immobility was recorded and analyzed by tail suspension software (SOF-821, Med Associates).

Sucrose consumption test (SCT)

The mice were acclimatized to 1% sucrose solution for 48 h before the test. Each mouse was individually housed and deprived of water for 12 h. The SCT was performed for 1 h, during which the amount of 1% sucrose solution consumed was recorded.

Sucrose preference test (SPT)

The mice were acclimatized to two-bottle drinking (one bottle contained water, and the other contained 1.5% sucrose solution) for 48 h, in which the position of each bottle was switched at 24 h. The mice were then deprived of drinking water for 24 h. The SPT was performed by providing the mice once again with two bottles for 2-h drinking, during which the position of each bottle was switched after 1 h. The ratio of sucrose solution consumed to the total fluid intake in the SPT was determined as the sucrose preference.

Social interaction test (SIT)

The SIT was performed in line with a previous report⁵⁰. It consisted of two 2.5-min-long phases: the first one was performed without a CD-1 mouse, and the second one was performed with a CD-1 mouse. The two phases were separated by a pause of 30 s. In both phases, each C57BL/6 J mouse was placed into the rear corner of the open field opposite the wire-mesh compartment. The time spent in the interaction zone (14 cm × 24 cm) was recorded and analyzed by the EthoVision video tracking system (Noldus, the Netherlands). The social interaction ratio was calculated as the ratio between the time spent in the interaction zone in the presence of a CD-1 mouse and the time spent in the absence of the CD-1 mouse. The brains of susceptible and control mice were harvested for gene expression analysis.

Novel suppressed feeding test (NSFT)

We performed the NSFT by referring to a previous study³². The Mice were deprived of food for 24 h. During the NSFT, and each mouse was placed into the corner of a square chamber (50 cm × 50 cm × 20 cm) opposite a food pellet left in the center of the chamber. The latency to start eating the pellet was recorded. If a mouse did not eat the pellet within 6 min, the latency was recorded as 6 min.

Open field test (OFT)

Each mouse was individually placed in one corner of a square Plexiglas box (50 cm × 50 cm × 40 cm) in a brightly lit room, allowing for free exploration of the open field arena for 10 min. The time spent in the center area of the box (12.5 cm × 12.5 cm) and the distance traveled in the box during the testing period were recorded and analyzed by the EthoVision video tracking system (Noldus, the Netherlands).

Elevated zero maze test (EZM)

The EZM was performed in a circular elevated maze with two open and two enclosed arms (height: 43.5 cm; diameter: 45 cm; track width: 6.5 cm). Each mouse was individually placed in the cross area of the maze facing the closed arms and allowed to freely explore the maze for 5 min. The time spent in the open arms and the distance traveled in the maze were recorded and analyzed by the EthoVision video tracking system (Noldus, the Netherlands).

Vector construction, rAAV packaging and administration

Mouse Fto and Sirt1 cDNAs were cloned into the rAAV expression vector with a CAG promoter. The Fto shRNA targeting 5′-GCAGCTGAAATACCCTAAACT -3′ was cloned into the rAAV expression vector with a U6 promoter. AAV-CAG-Fto-2A-EGFP (Cat. # AAV2/9-XT071), AAV-CAG-Sirt1 (Cat. # AAV2/9-XT393), AAV-U6-Fto shRNA-CMV-ZsGreen (Cat. # AAV2/9-XT071), AAV-CMV-bGlobin-Cre-eGFP (Cat. # AAV2/9-S0231-9-H50), and AAV-CMV-bGlobin-eGFP-WPRE (Cat. # AAV2/9-S0263-9-H50) were packaged by Taitool Bioscience (Shanghai Taitool Bioscience Co.Ltd., China). The final titer of each rAAV was 3 × 10¹²–4 × 10¹² vector genome (v.g.)/mL.

RNA preparation for quantitative real-time PCR

Total RNA from the hippocampus was extracted using TRIzol (Thermo Fisher Scientific, USA) in line with the manufacturer’s instructions, and the RNA samples were stored at −80 °C. One microgram of total RNA was used to synthesize cDNA by the Transcriptor First Strand cDNA Synthesis kit (04897030001, Roche). Quantitative PCR was performed using FastStart Essential DNA Green Master Mix (06924204001, Roche) on a LightCycler 96 Real-Time System (Roche). The primers used in the qPCR analysis are shown in Supplementary Table 4. Each reaction was performed in triplicate. A fragment of Gapdh was amplified as the internal control. Differences in gene expression were calculated by the 2^-ΔΔCT method and are presented as the fold change.

Western blot analysis

The brain samples were lysed in RIPA lysis buffer with protease inhibitor cocktail (B14001, Bimake) by a tissue homogenizer, followed by ultrasonication and centrifugation. The bicinchoninic acid method was used to determine the concentrations of proteins that were mixed with 5 × Laemmli sample buffer and denatured for 5 min at 95 °C. A total of 30 µg of each sample was separated by 8% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred onto nitrocellulose membranes. The membranes were incubated with blocking buffer (TBST buffer containing 5% skim milk powder) for 60 min at room temperature. Next, the membranes were incubated overnight at 4 °C with the primary antibodies. The primary antibodies were as follows: anti-FTO (1:1000, ab92821, Abcam), anti-ADRB2 (1:1000, ab182136, Abcam), anti-SIRT1 (1:1000, 8469 S, Cell Signaling Technology), anti-c-MYC (9402 S, 1:1000, Cell Signaling Technology), and anti-GAPDH (1:10000, GTX100118, GeneTex), HRP-conjugated secondary anti-rabbit (1:5000, GTX213110-01, GeneTex), and HRP-conjugated secondary anti-mouse (1:5000, GTX213111-01, GeneTex). After incubation for 1 h with the corresponding secondary antibodies, the protein bands were detected by chemiluminescence using an ECL reagent.

Stereotaxic surgery

Ten-week-old male mice were stereotaxically injected with rAAVs. The mice were anesthetized with 0.7% pentobarbital sodium via intraperitoneally. One microliter of rAAV per side was microinjected bilaterally into the hippocampus (2.2 mm posterior to bregma, ±2.1 mm lateral to midline, and 1.7 mm ventral to bregma) at a rate of 300 nanoliters/min with a Micro4 Syringe Pump Controller (World Precision Instruments, USA). Four weeks later, further experiments were performed. In the experiment of drug infusion into hippocampus, cannulas were implanted bilaterally following the abovementioned coordinates. One week after surgery, formoterol was infused into the hippocampus bilaterally (1 μL each side) at a concentration of 0.4 μg/μL.

m⁶A Dot blot

Total RNA in three sample volumes of RNA incubation solution was denatured at 65 °C for 5 min and immediately chilled on ice. The RNA samples were spotted in triplicate onto an Amersham Hybond-N+ membrane (RPN119B, GE Healthcare) with a Bio-Dot Apparatus (#170-6545, Bio-Rad). Next, they were cross-linked to the membrane by ultraviolet light and blocked with a blocking buffer (PBST buffer containing 5% nonfat milk). The membrane was incubated overnight at 4 °C with anti-m⁶A antibody (1:5000, 202003, Synaptic Systems) followed by incubation with an HRP-conjugated goat anti-rabbit IgG (1:5000, sc-2030, Santa Cruz Biotechnology) for one hour at room temperature. Finally, the signal was detected by a chemiluminescent reaction using an ECL reagent.

MeRIP-seq

A refined MeRIP-Seq (N6-methyladenosine (m⁶A) RNA immunoprecipitation sequencing) method was performed based on a previously described protocol^51,52. Each sample was pooled from three mice. The number of samples in each group was as follows: Ctl, n = 2; OE, n = 2; KD, n = 3; Ctl-cKO, n = 3; cKO, n = 2. RNA was fragmented with the RNA Fragmentation Buffer in the Magna MeRIP™ m⁶A Kit- Transcriptome-wide Profiling of N6-Methyladenosine (17-10499, Millipore). Two microliters of 10 × Fragmentation Buffer were added into 18 µL of mRNA samples. The samples were incubated in the thermal cycler block at 94 °C for 4 min. The samples were taken out from the block and treated with 2 µL of 0.5 M EDTA to stop the reactions. Fragmented RNA was purified by the RNeasy MiniElute Cleanup Kit (QIAGEN, 74204). After enriching for methylated RNA fragments with a specific anti-m⁶A antibody (1:100, ABE572, Millipore), the m6A-seq library was constructed using the SMARTer Stranded Total RNA-Seq Kit-v2 (Pico Input Mammalian, 634413, Takara/Clontech, Japan) and sequenced on Illumina Novaseq 6000.

Bioinformatics analysis of high-throughput sequencing data

Alignment

The sequencing data were analyzed in accordance with the optimized pipeline for refined MeRIP-Seq described in a previous study⁵². The quality control of raw data was performed by FASTQC (version 0.11.5). The clean reads from the m⁶A IP (m⁶A-seq) were aligned to the mouse genome (mm10) using the STAR aligner (version 2.7) with the default parameters after removing reads containing adapters and low-quality reads with Cutadapt (version 1.18). Only uniquely mapped and unduplicated reads remained for the subsequent analysis.

m⁶A peak calling and motif analysis

MeTPeak (version 1.1) with the default settings was used for the transcriptome-wide detection of m6A sites in each sample based on the alignment files generated by STAR aligner. The R package Guitar was used to illustrate the distribution of m6A peaks in mRNA⁵³. The top 3000 peaks were selected for motif analysis with DREME (version 5.1.1), which used 100-nt-long peak summit-centered sense sequences as an input. The peaks were annotated to the overlapping genomic features and visualized with ChIPseeker (version 1.22.1)⁵⁴ using annotations from TxDb.Mmusculus.UCSC.mm10.knownGene. The peaks were assigned to seven regions, including the promoter, 5′ UTR, 3′ UTR, exon, intron, and downstream and distal intergenic regions.

Detection of differential methylation peaks (DMPs)

DMPs were identified in accordance with the pipeline described in the previous study⁵². Four groups were included in our study, including wild-type (WT), KD, cKO and OE mice. The following steps were taken to identify DMPs between three groups based on the expression levels in Fto-modified and control samples (WT mice). First, the overlapping m⁶A peaks from two samples were defined as common peaks. The common peaks between samples from the same group were merged and combined with the common peaks from another group to form the m⁶A union peaks reference list. The enrichment score of each sample for each peak was obtained by dividing the read counts for IP by the input. High confidence DMPs meeting the criteria of an average enrichment score higher than 6 in the groups and a log2 fold change >1 or <−1 were selected for further analysis. The DMPs were annotated in accordance with the genomic features with ChIPseeker (version 1.22.1). Functional enrichment analysis of the gene ontology (GO) and pathways was performed using ChIPseeker (version 1.22.1) to identify the predominant biological functions of the annotated genes nearest to the DMPs. Fisher’s exact test was applied to identify the significant GO categories and pathways, and FDR correction was performed with a threshold of 0.05. Input RNA before immunoprecipitation was applied to RNA-seq in parallel.

Gene-specific m⁶A qPCR

The Magna MeRIP m⁶A kit (17-10499, Millipore) was used to perform m⁶A RNA immunoprecipitation in line with the manufacturer’s instructions. A QuantiTect SYBR Green RT-PCR Kit (204243, Qiagen) was used to perform reverse transcription and real-time qPCR. The relative expression of the m⁶A-modified target gene was determined as the Cq value of the m⁶A IP portion divided by the Cq value of the input portion.

RNA stability

Neuro-2a cells cultured in 6-well plates at 80–90% confluence were transfected with 2 µg of Fto-shRNA, FTO overexpression, or control vector. Forty-eight hours later, the cells were treated with 5 μg/ml actinomycin D (A9415, Sigma) and harvested at 0, 3 and 6 h. Total RNA was extracted using TRIzol, and 1 μg of total RNA was used for reverse transcription and qPCR.

Luciferase assay

In Adrb2 3' UTR fragment, there are a total of four possible m⁶A modification sites, predicted by the “DRACH” motif (D = A/G, R = A/G, H = A/C/T) from the MeRIP-analysis²². We generated a mutant fragment by replacing “A” into “T” in all the four possible m⁶A modification sites. Wild type and mutant Adrb2-3' UTR were synthetized and inserted into pMIR-GLO vectors (Tsingke). For dual-luciferase reporter assays, 50 ng pMIR-GLO vectors and 50 ng pcDNA3.1_Fto or pcDNA3.1_mutFto were co-transfected into HEK293 cells in 24-well plates. The mutant FTO-expressing vector contains the full-length Fto coding region with mutations at H231A and D233A, which results in complete loss of m⁶A demethylation activity^55,56. Relative luciferase activities were assessed by Dual-Luciferase Reporter Assay System (Promega) after 48 h transfection.

(1)
Adrb2-3' UTR with wild-type m⁶A sites

TCTAGATAGTGTCCTGTCAAGGAGGGGTCTTAGAGAGTAGAAAGCCTGTATTACAGTGGCGAGTCATTTGTACTACAGTTCCTTCCTTGGGAGTCAACGCTAAGGCTAGGCACAGTACCTTGACAGTTCACAAAGCCTTCCATGCCTGGGGGATCCTCACACAGCAGTTCCTGTTCTCTCTCCTGCCCCAGCTGACAAGTGTTTGGCTCCCCTGTGTAGTCCGTTCTGCCGTTGCTATTGCTAGAGTAGCCGTTCCCATAGGTTTTCGAAGAAGACCTGCGAAGGCACAGAAGCTCTTGAAAGGCAATCCTGAAATCTGGACTCCGACAGTAGATAAGAGGATTGAAGGCAGAGTTGACGTAGCCCAACCAGTTAAGGAGGATGTAAACTTCCTTAGGGATGAGGTTGTCCCTGATAACGTGCACGATATTGACAATGAAGAAGGGCAGCCAGCAGAGGGTGAATGTGCCCATGATGATGCCTAAAGTCTTGAGGGCTTTGTGCTCTTTCAAGCAGAACTTGGAGGACCTTCGGAGTCCGTGGCCGCTCCGCCCATCCTGCTCCACCTGGCTGAGGTTTTGGGCGTGGAATCTTCCTTCGCGGCCGC
(2)
Adrb2-3' UTR with mutant m⁶A sites

TCTAGATAGTGTCCTGTCAAGGAGGGGTCTTAGAGAGTAGAAAGCCTGTATTACAGTGGCGAGTCATTTGTACTACAGTTCCTTCCTTGGGAGTCAACGCTAAGGCTAGGCACAGTACCTTGACAGTTCACAAAGCCTTCCATGCCTGGGGGATCCTCACACAGCAGTTCCTGTTCTCTCTCCTGCCCCAGCTGACAAGTGTTTGGCTCCCCTGTGTAGTCCGTTCTGCCGTTGCTATTGCTAGAGTAGCCGTTCCCATAGGTTTTCGAAGAAGTCCTGCGAAGGCACAGAAGCTCTTGAAAGGCAATCCTGAAATCTGGTCTCCGACAGTAGATAAGAGGATTGAAGGCAGAGTTGACGTAGCCCAACCAGTTAAGGAGGATGTAAACTTCCTTAGGGATGAGGTTGTCCCTGATAACGTGCACGATATTGACAATGAAGAAGGGCAGCCAGCAGAGGGTGAATGTGCCCATGATGATGCCTAAAGTCTTGAGGGCTTTGTGCTCTTTCAAGCAGATCTTGGAGGTCCTTCGGAGTCCGTGGCCGCTCCGCCCATCCTGCTCCACCTGGCTGAGGTTTTGGGCGTGGAATCTTCCTTCGCGGCCGC

Golgi staining

The mice were anesthetized with chloral hydrate (10%, wt/vol, i.p.) and sequentially perfused transcardially with saline. The whole brain was freshly harvested and immediately immersed in one well of a 12-well plate containing 5 mL of solution A (superGolgi Kit, Cat. # 003010, Bioenno Tech, LLC). In accordance with the manufacturer’s instructions, the solution was renewed two days later, and the impregnation continued for another nine days. Next, the brain was transferred to postimpregnation buffer for two days with renewal of the solution after one day of immersion. Sections (100 μm) in thickness were cut using a vibratome (VT1200S, Leica). The sections were mounted on adhesive microscope slides (SUPERFROST® PLUS, Cat. # 4951 PLUS-100E, Thermo Scientific). The staining time in solutions C and D was 20 min. Then, the sections were dehydrated in 100% ethanol for 7 min four times each, which was followed by vitrification with xylene for 8 min 10 times each. Finally, the sections were coverslipped with neutral resins. For spine density measurement, we imaged one terminal dendrite from the CA1 region of the hippocampus using a 100 × objective on a microscope (DM6 B, Leica). A Z-stack of images with an interval of 0.22 μm was acquired for each dendritic segment, which was followed by an extended depth of field algorithm calculation to obtain in focus images using LAS X software (Leica Application Suite X, Leica). The diameters of the selected segments were comparable. A total of 120 segments from 20 mouse brains (six segments per animal) were used to determine the spine number. The dendritic spines, including thin, stubby, and mushroom types, within a 15-μm length segment were counted manually by an investigator blinded to the experimental treatments.

ChIP-qPCR

SimpleChIP Plus Enzymatic chromatin IP kit (Cell Signaling Technology; #9005) was used to perform ChIP assay. N2A cells (10⁶ per ChIP sample) were cross-linked with 1% formaldehyde and incubated at 37 °C for 10 min, then stopped by glycine. Micrococcal nuclease was added into cells to digest nuclei, and the lysates were sonicated to disrupt nuclear membranes. The samples were incubated with 5 µg c-MYC antibodies overnight at 4 °C, and then immunoprecipitated with protein G magnetic beads for 2 h. Eluted DNA was used for ChIP–qPCR analysis with primers listed in Supplementary Table 4.

Statistical analysis

Statistical analysis was conducted using the Prism software (GraphPad Prism 8). Two-tailed student’s t test was used for comparisons between the two groups, and one-way or two-way analysis of variance (ANOVA) was performed for more than two groups. p < 0.05 was considered statistically significant. All the data were exported into Adobe Photoshop CS6 for the preparation of figures. All data are shown as the mean ± standard error of mean (s.e.m).

Reporting summary

Further information on research design is available in the Nature Research Reporting Summary linked to this article.

Data availability

The MeRIP-seq data generated in this study have been deposited in the Genome Sequence Archive under accession code CRA005192 (https://ngdc.cncb.ac.cn/gsa/)^57,58. Uncropped and unprocessed scans are supplied in the Source data. Source data are provided as a Source Data.xlsx. Source data are provided with this paper.

References

Otte, C. et al. Major depressive disorder. Nat. Rev. Dis. Prim. 2, 16065 (2016).
Article PubMed Google Scholar
Binder, E. B. Dissecting the molecular mechanisms of gene x environment interactions: implications for diagnosis and treatment of stress-related psychiatric disorders. Eur. J. Psychotraumatol. 8, 1412745 (2017).
Article PubMed Google Scholar
Pena, C. J. & Nestler, E. J. Progress in epigenetics of depression. Prog. Mol. Biol. Transl. Sci. 157, 41–66 (2018).
Article CAS PubMed PubMed Central Google Scholar
Livneh, I., Moshitch-Moshkovitz, S., Amariglio, N., Rechavi, G. & Dominissini, D. The m(6)A epitranscriptome: transcriptome plasticity in brain development and function. Nat. Rev. Neurosci. 21, 36–51 (2020).
Article CAS PubMed Google Scholar
Meyer, K. D. et al. Comprehensive analysis of mRNA methylation reveals enrichment in 3′ UTRs and near stop codons. Cell 149, 1635–1646 (2012).
Article CAS PubMed PubMed Central Google Scholar
Yang, Y., Hsu, P. J., Chen, Y. S. & Yang, Y. G. Dynamic transcriptomic m(6)A decoration: writers, erasers, readers and functions in RNA metabolism. Cell Res. 28, 616–624 (2018).
Article CAS PubMed PubMed Central Google Scholar
Gerken, T. et al. The obesity-associated FTO gene encodes a 2-oxoglutarate-dependent nucleic acid demethylase. Science 318, 1469–1472 (2007).
Article ADS CAS PubMed PubMed Central Google Scholar
Gao, X. et al. The fat mass and obesity associated gene FTO functions in the brain to regulate postnatal growth in mice. PLoS ONE 5, e14005 (2010).
Article ADS PubMed PubMed Central Google Scholar
Hess, M. E. et al. The fat mass and obesity associated gene (Fto) regulates activity of the dopaminergic midbrain circuitry. Nat. Neurosci. 16, 1042–1048 (2013).
Article CAS PubMed Google Scholar
Widagdo, J. et al. Experience-dependent accumulation of N6-methyladenosine in the prefrontal cortex is associated with memory processes in mice. J. Neurosci. 36, 6771–6777 (2016).
Article CAS PubMed PubMed Central Google Scholar
Engel, M. et al. The role of m6A/m-RNA methylation in stress response regulation. Neuron 99, 389–403 (2018).
Article CAS PubMed PubMed Central Google Scholar
Li, L. et al. Fat mass and obesity-associated (FTO) protein regulates adult neurogenesis. Hum. Mol. Genet. 26, 2398–2411 (2017).
Article CAS PubMed PubMed Central Google Scholar
Spychala, A. & Rüther, U. FTO affects hippocampal function by regulation of BDNF processing. PLoS ONE 14, e211937 (2019).
Article Google Scholar
Walters, B. J. et al. The role of the RNA demethylase FTO (fat mass and obesity-associated) and mRNA methylation in hippocampal memory formation. Neuropsychopharmacology 42, 1502–1510 (2017).
Article CAS PubMed PubMed Central Google Scholar
Weng, Y. L. et al. Epitranscriptomic m(6)A regulation of axon regeneration in the adult mammalian nervous system. Neuron 97, 313–325 (2018).
Article CAS PubMed PubMed Central Google Scholar
Milaneschi, Y. et al. The effect of FTO rs9939609 on major depression differs across MDD subtypes. Mol. Psychiatry 19, 960–962 (2014).
Article CAS PubMed Google Scholar
Samaan, Z. et al. The protective effect of the obesity-associated rs9939609 A variant in fat mass- and obesity-associated gene on depression. Mol. Psychiatry 18, 1281–1286 (2013).
Article CAS PubMed Google Scholar
Rivera, M. et al. Depressive disorder moderates the effect of the FTO gene on body mass index. Mol. Psychiatry 17, 604–611 (2012).
Article CAS PubMed Google Scholar
Sun, L. et al. Fto deficiency reduces anxiety- and depression-like behaviors in mice via alterations in gut microbiota. Theranostics 9, 721–733 (2019).
Article CAS PubMed PubMed Central Google Scholar
Dominissini, D. et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 485, 201–206 (2012).
Article ADS CAS PubMed Google Scholar
Bortolotto, V. et al. Salmeterol, a beta2 adrenergic agonist, promotes adult hippocampal neurogenesis in a region-specific manner. Front Pharmacol. 10, 1000 (2019).
Article CAS PubMed PubMed Central Google Scholar
Dang, V. et al. Formoterol, a long-acting β2 adrenergic agonist, improves cognitive function and promotes dendritic complexity in a mouse model of Down syndrome. Biol. Psychiat. 75, 179–188 (2014).
Article CAS PubMed Google Scholar
Havekes, R. et al. Gravin orchestrates protein kinase A and 2-adrenergic receptor signaling critical for synaptic plasticity and memory. J. Neurosci. 32, 18137–18149 (2012).
Article CAS PubMed PubMed Central Google Scholar
Li, S. et al. Environmental novelty activates beta2-adrenergic signaling to prevent the impairment of hippocampal LTP by Abeta oligomers. Neuron 77, 929–941 (2013).
Article CAS PubMed PubMed Central Google Scholar
Zhang, H., Huang, Y. & O’Donnell, J. M. Antagonism of the antidepressant-like effects of clenbuterol by central administration of?-adrenergic antagonists in rats. Psychopharmacology 170, 102–107 (2003).
Article CAS PubMed Google Scholar
Wang, X. et al. N6-methyladenosine-dependent regulation of messenger RNA stability. Nature 505, 117–120 (2014).
Article ADS PubMed Google Scholar
Duman, R. S. & Aghajanian, G. K. Synaptic dysfunction in depression: potential therapeutic targets. Science 338, 68–72 (2012).
Article ADS CAS PubMed PubMed Central Google Scholar
Gao, J. et al. A novel pathway regulates memory and plasticity via SIRT1 and miR-134. Nature 466, 1105–1109 (2010).
Article ADS CAS PubMed PubMed Central Google Scholar
Michan, S. et al. SIRT1 is essential for normal cognitive function and synaptic plasticity. J. Neurosci. 30, 9695–9707 (2010).
Article CAS PubMed PubMed Central Google Scholar
Abe-Higuchi, N. et al. Hippocampal sirtuin 1 signaling mediates depression-like behavior. Biol. Psychiatry 80, 815–826 (2016).
Article CAS PubMed Google Scholar
Chen, H. et al. beta2-AR activation induces chemoresistance by modulating p53 acetylation through upregulating Sirt1 in cervical cancer cells. Cancer Sci. 108, 1310–1317 (2017).
Article CAS PubMed PubMed Central Google Scholar
Yuan, J., Minter-Dykhouse, K. & Lou, Z. A c-Myc-SIRT1 feedback loop regulates cell growth and transformation. J. Cell Biol. 185, 203–211 (2009).
Article CAS PubMed PubMed Central Google Scholar
Zhou, X. et al. Sirtuin 1 inhibition delays cyst formation in autosomal-dominant polycystic kidney disease. J. Clin. Invest. 123, 3084–3098 (2013).
Article CAS PubMed PubMed Central Google Scholar
Joffe, R. T., Bagby, R. M. & Levitt, A. Anxious and nonanxious depression. Am. J. Psychiatry 150, 1257–1258 (1993).
Article CAS PubMed Google Scholar
Fava, M. et al. Major depressive subtypes and treatment response. Biol. Psychiatry 42, 568–576 (1997).
Article CAS PubMed Google Scholar
Fava, M. et al. Clinical correlates and symptom patterns of anxious depression among patients with major depressive disorder in STAR*D. Psychol. Med. 34, 1299–1308 (2004).
Article PubMed Google Scholar
Branca, C., Wisely, E. V., Hartman, L. K., Caccamo, A. & Oddo, S. Administration of a selective beta2 adrenergic receptor antagonist exacerbates neuropathology and cognitive deficits in a mouse model of Alzheimer’s disease. Neurobiol. Aging 35, 2726–2735 (2014).
Article CAS PubMed PubMed Central Google Scholar
O’Donnell, J. M. Behavioral consequences of activation of beta adrenergic receptors by clenbuterol: evidence for mediation by the central nervous system. Brain Res. Bull. 21, 491–497 (1988).
Article PubMed Google Scholar
Cai, N. et al. Sparse whole-genome sequencing identifies two loci for major depressive disorder. Nature. 523, 588–591 (2015).
Article ADS CAS Google Scholar
Luo, X. J. & Zhang, C. Down-regulation of SIRT1 gene expression in major depressive disorder. Am. J. Psychiatry 173, 1046 (2016).
Article PubMed Google Scholar
Kim, H. D. et al. SIRT1 mediates depression-like behaviors in the nucleus accumbens. J. Neurosci. 36, 8441–8452 (2016).
Article CAS PubMed PubMed Central Google Scholar
Lei, Y. et al. SIRT1 in forebrain excitatory neurons produces sexually dimorphic effects on depression-related behaviors and modulates neuronal excitability and synaptic transmission in the medial prefrontal cortex. Mol. Psychiatry 25, 1094–1111 (2019).
Article PubMed PubMed Central Google Scholar
Lu, G. et al. Role and possible mechanisms of Sirt1 in depression. Oxid. Med. Cell. Longev. 2018, 1–6 (2018).
Google Scholar
Menssen, A. et al. The c-MYC oncoprotein, the NAMPT enzyme, the SIRT1-inhibitor DBC1, and the SIRT1 deacetylase form a positive feedback loop. Proc. Natl Acad. Sci. USA 109, E187–E196 (2012).
Article CAS PubMed Google Scholar
Su, R. et al. Targeting FTO suppresses cancer stem cell maintenance and immune evasion. Cancer Cell. 38, 79–96 (2020).
Article CAS PubMed PubMed Central Google Scholar
Peng, S. et al. Identification of entacapone as a chemical inhibitor of FTO mediating metabolic regulation through FOXO1. Sci. Transl. Med. 11, eaau7116 (2019).
Article PubMed Google Scholar
Liu, C., Lee, S. & Elmquist, J. K. Circuits controlling energy balance and mood: inherently intertwined or just complicated intersections? Cell Metab. 19, 902–909 (2014).
Article CAS PubMed PubMed Central Google Scholar
Liu, S. et al. Inverse changes in L1 retrotransposons between blood and brain in major depressive disorder. Sci. Rep. 6, 37530 (2016).
Article ADS CAS PubMed PubMed Central Google Scholar
Haenisch, B., Bilkei-Gorzo, A., Caron, M. G. & Bonisch, H. Knockout of the norepinephrine transporter and pharmacologically diverse antidepressants prevent behavioral and brain neurotrophin alterations in two chronic stress models of depression. J. Neurochem. 111, 403–416 (2009).
Article CAS PubMed PubMed Central Google Scholar
Golden, S. A., Covington, H. R., Berton, O. & Russo, S. J. A standardized protocol for repeated social defeat stress in mice. Nat. Protoc. 6, 1183–1191 (2011).
Article CAS PubMed PubMed Central Google Scholar
Dominissini, D., Moshitch-Moshkovitz, S., Salmon-Divon, M., Amariglio, N. & Rechavi, G. Transcriptome-wide mapping of N(6)-methyladenosine by m(6)A-seq based on immunocapturing and massively parallel sequencing. Nat. Protoc. 8, 176–189 (2013).
Article CAS PubMed Google Scholar
Zeng, Y. et al. Refined RIP-seq protocol for epitranscriptome analysis with low input materials. PLoS Biol. 16, e2006092 (2018).
Article PubMed PubMed Central Google Scholar
Cui, X. et al. Guitar: an R/Bioconductor package for gene annotation guided transcriptomic analysis of RNA-related genomic features. Biomed. Res. Int. 2016, 8367534 (2016).
Article PubMed PubMed Central Google Scholar
Yu, G., Wang, L. G. & He, Q. Y. ChIPseeker: an R/Bioconductor package for ChIP peak annotation, comparison and visualization. Bioinformatics. 31, 2382–2383 (2015).
Article CAS PubMed Google Scholar
Jia, G. et al. N6-methyladenosine in nuclear RNA is a major substrate of the obesity-associated FTO. Nat. Chem. Biol. 7, 885–887 (2011).
Article CAS PubMed PubMed Central Google Scholar
Lin, L., Hales, C. M., Garber, K. & Jin, P. Fat mass and obesity-associated (FTO) protein interacts with CaMKII and modulates the activity of CREB signaling pathway. Hum. Mol. Genet. 23, 3299–3306 (2014).
Article CAS PubMed PubMed Central Google Scholar
Chen, T. et al. The Genome Sequence Archive Family: Toward Explosive Data Growth and Diverse Data Types. Genomics, Proteomics & Bioinformatics. S1672-0229, 00163-7 (2021).
Xue, Y. et al. Database Resources of the National Genomics Data Center, China National Center for Bioinformation in 2021. Nucleic Acids Res. 49, D18–D28 (2021).
Article CAS Google Scholar

Download references

Acknowledgements

This work was supported by the research grants from the National Natural Science Foundation of China (81625008 & 81930104 to Q.X., 31970952 to J.X., and 82101545 to W.Z.), the National Key Research and Development Program of China (2020YFA0804502 to Q.X. and 2016YFC1306700 to J.X.), CAMS Innovation Fund for Medical Sciences (2021-1-I2M-020 to Q.X.), Science and Technology Program of Guangdong (2018B030334001 to Q.X.). We thank the Human Brain Bank, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing, China for providing the hippocampal tissues of the human brain. We thank Nannan Sun and Zeyue Liu for establishing mouse models of depression.

Author information

These authors contributed equally: Shu Liu, Jianbo Xiu, Caiyun Zhu, Kexin Meng.

Authors and Affiliations

State Key Laboratory of Medical Molecular Biology, Institute of Basic Medical Sciences Chinese Academy of Medical Sciences, School of Basic Medicine Peking Union Medical College, Beijing, 100005, China
Shu Liu, Jianbo Xiu, Caiyun Zhu, Kexin Meng, Chen Li, Rongrong Han, Tingfu Du, Lanlan Li, Lingdan Xu, Renjie Liu, Wanwan Zhu, Yan Shen & Qi Xu
Neuroscience Center, Chinese Academy of Medical Sciences, Beijing, 100005, China
Shu Liu, Jianbo Xiu, Caiyun Zhu, Kexin Meng, Chen Li, Rongrong Han, Tingfu Du, Lanlan Li, Lingdan Xu, Renjie Liu, Wanwan Zhu, Yan Shen & Qi Xu

Authors

Shu Liu
View author publications
You can also search for this author in PubMed Google Scholar
Jianbo Xiu
View author publications
You can also search for this author in PubMed Google Scholar
Caiyun Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Kexin Meng
View author publications
You can also search for this author in PubMed Google Scholar
Chen Li
View author publications
You can also search for this author in PubMed Google Scholar
Rongrong Han
View author publications
You can also search for this author in PubMed Google Scholar
Tingfu Du
View author publications
You can also search for this author in PubMed Google Scholar
Lanlan Li
View author publications
You can also search for this author in PubMed Google Scholar
Lingdan Xu
View author publications
You can also search for this author in PubMed Google Scholar
Renjie Liu
View author publications
You can also search for this author in PubMed Google Scholar
Wanwan Zhu
View author publications
You can also search for this author in PubMed Google Scholar
Yan Shen
View author publications
You can also search for this author in PubMed Google Scholar
Qi Xu
View author publications
You can also search for this author in PubMed Google Scholar

Contributions

Q.X. and J.X. conceived the study and designed the experiments. S.L., J.X., C.L., L.X., L.L. and R.L performed behavioral tests. J.X., R.H., T.D., S.L., L.L. and L.X. established the mouse models of depression. T.D. conducted the microarray analysis of human peripheral blood. S.L., J.X., R.H., K.M. and R.L performed the qPCR analysis. S.L., L.L. and K.M. performed the MeRIP experiments. C.Z. conducted bioinformatics analysis of MeRIP data. S.L. performed gene-specific m6A qPCR and RNA stability assay. S.L. and K.M. performed m6A dot blot and luciferase assay. S.L., J.X. and C.L. conducted western blot experiments. J.X. performed Golgi staining experiment. S.L and R.L performed ChIP-qPCR. S.L., J.X. and C.Z. analyzed the main data. Q.X., S.L., J.X. and C.Z. wrote the manuscript. W.Z., Y.S. and Q.X. supervised the work.

Corresponding author

Correspondence to Qi Xu.

Ethics declarations

Competing interests

The authors declare no competing interests.

Additional information

Peer review information Nature Communications thanks the anonymous reviewer(s) for their contribution to the peer review of this work.

Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary information

Supplementary Information

Reporting summary

Source data

Source Data

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Cite this article

Liu, S., Xiu, J., Zhu, C. et al. Fat mass and obesity-associated protein regulates RNA methylation associated with depression-like behavior in mice. Nat Commun 12, 6937 (2021). https://doi.org/10.1038/s41467-021-27044-7

Download citation

Received: 31 January 2021
Accepted: 28 October 2021
Published: 26 November 2021
DOI: https://doi.org/10.1038/s41467-021-27044-7

This article is cited by

mTORC1 accelerates osteosarcoma progression via m6A-dependent stabilization of USP7 mRNA
- Zhengming Yang
- Wei Yu
- Dimin Wang
Cell Death Discovery (2024)
m6A/m1A/m5C-Associated Methylation Alterations and Immune Profile in MDD
- Xin Ren
- Zhuxiao Feng
- Changhe Fan
Molecular Neurobiology (2024)
SARS-CoV-2 envelope protein triggers depression-like behaviors and dysosmia via TLR2-mediated neuroinflammation in mice
- Wenliang Su
- Jiahang Ju
- Dongliang Mu
Journal of Neuroinflammation (2023)
Comprehensive analysis of N6-methyladenosine-related RNA methylation in the mouse hippocampus after acquired hearing loss
- Xuehua Zhou
- Lin Jin
- Xia Shen
BMC Genomics (2023)
FTO-mediated m6A demethylation regulates GnRH expression in the hypothalamus via the PLCβ3/Ca2+/CAMK signalling pathway
- Shaolian Zang
- Xiaoqin Yin
- Pin Li
Communications Biology (2023)

Comments

By submitting a comment you agree to abide by our Terms and Community Guidelines. If you find something abusive or that does not comply with our terms or guidelines please flag it as inappropriate.

Subjects

Abstract

Similar content being viewed by others

Introduction

Results

The expression of FTO is downregulated in the hippocampus of MDD patients and mouse models of depression

FTO mediates depression-like behaviors in the hippocampus

Modification of the hippocampal m6A epitranscriptome by FTO

ADRB2 is a target gene of FTO in the hippocampus

ADRB2 activation reverses the depression-like behaviors and spine loss induced by hippocampal Fto deficiency

ADRB2 mediates depression-like behaviors possibly via the modulation of hippocampal SIRT1 expression by c-MYC

Discussion

Methods

Human subjects

Microarray

Animals

Cell culture

Drug administration

Mouse models of depression

Unpredictable chronic mild stress (UCMS)

Chronic restraint stress (CRS)

Social defeat stress (SDS)

Behavioral tests

Forced swimming test (FST)

Tail suspension test (TST)

Sucrose consumption test (SCT)

Sucrose preference test (SPT)

Social interaction test (SIT)

Novel suppressed feeding test (NSFT)

Open field test (OFT)

Elevated zero maze test (EZM)

Vector construction, rAAV packaging and administration

RNA preparation for quantitative real-time PCR

Western blot analysis

Stereotaxic surgery

m6A Dot blot

MeRIP-seq

Bioinformatics analysis of high-throughput sequencing data

Alignment

m6A peak calling and motif analysis

Detection of differential methylation peaks (DMPs)

Gene-specific m6A qPCR

RNA stability

Luciferase assay

Golgi staining

ChIP-qPCR

Statistical analysis

Reporting summary

Data availability

References

Acknowledgements

Author information

Authors and Affiliations

Contributions

Corresponding author

Ethics declarations

Competing interests

Additional information

Supplementary information

Source data

Rights and permissions

About this article

Cite this article

Share this article

This article is cited by

Comments

Search

Quick links

Modification of the hippocampal m⁶A epitranscriptome by FTO

m⁶A Dot blot

m⁶A peak calling and motif analysis

Gene-specific m⁶A qPCR